Takara
PCR How to Select the Best PCR Enzyme Guide to Takara PCR Polymerases High Fidelity PCR High Speed PCR High Performance PCR DNA Bisulphite Modification Real Time (qPCR) Kits General PCR Products RT-PCR and RACE Food Pathogen Detection & Screening Kits PCR Probes & Primer Sets Molecular Biology Cloning, Mapping & cDNA Synthesis Gene Transfer & Expression RNA/Protein/DNA Extraction Nucleic Acids Electrophoresis Instrumentation DNA Labeling & Detection Kits Sequencing, Mutagenesis & Mutation Analysis Molecular Biology Reagents Restriction Enzymes Modifying Enzymes: Kinases & RT Modifying Enzymes: Phosphatases Modifying Enzymes: Ligases Modifying Enzymes: DNA Polymerase Modifying Enzymes: RNA Polymerase Modifying Enzymes: Nucleases Modifying Enzymes: Rnase Inhibitor DNA Microarray Accessories Cell Biology Apoptosis Antibodies Bone Research Products Cell Adhesion & Extracellular Matrix Cell Differentiation Kit Cell Proliferation & Viability Signal Transduction Viral & Microbial Detection Protein Research Recombinant Protein Folding & Expression C-Terminal Isolation & Analysis N-Terminal Deblocking & Analysis Protein Fragmentation Protease Inhibition Glycobiology Glycobiology Kits Related Enzymes Order Products
About Takara Bio USA Clontech-Takara Bio USA Merger Contact Us Takara Subsidiares and Distributors How to Order Career Opportunities
Press Releases Trade Shows Company News
Home > Products > Molecular Biology > Nucleic Acids > Ladderman™ (BcaBEST™) Sequencing Primers Details

Ladderman™ (BcaBEST™) Sequencing Primers

Description:

Purity
  • Confirmed by HPLC
  • Primer activity is confirmed by Sanger dideoxy method

 

Intended Usage

Primers for DNA sequencing of fragments cloned in M13mp type vector, pUC or pBluescript® II type vectors.

Note: pBluescript® is a registered trademark of Stratagene.

Shipping
Room temperature

Form:

Lyophilized

Storage:

–20°C

Ladderman™ Sequencing Primer RV-M TAK 3880 120 pmol 56.00
Ladderman™ Sequencing Primer M13-20 TAK 3881 120 pmol d(CGACGTTGTAAAACGACGGCCAGT) 56.00
Ladderman™ Sequencing Primer M13-47 TAK 3887 120 pmol d(CGCCAGGGTTTTCCCAGTCACGAC) 56.00
Ladderman™ Sequencing Primer RV-P TAK 3882 120 pmol d(GGAAACAGCTATGACCATGATTAC) 56.00
Ladderman™ Sequencing Primer T3 TAK 3883 120 pmol d(ATTAACCCTCACTAAAGGGAA) 56.00
Ladderman™ Sequencing Primer T7 TAK 3884 120 pmol d(TAATACGACTCACTATAGGG) 56.00
Ladderman™ Sequencing Primer BS TAK 3885 120 pmol d(CCCTCGAGGTCGACGGTATCGATA) 56.00
Product Name Product Number Size Features Price Qty Add

*All prices in USD