Takara
PCR How to Select the Best PCR Enzyme Guide to Takara PCR Polymerases High Fidelity PCR High Speed PCR High Performance PCR DNA Bisulphite Modification Real Time (qPCR) Kits General PCR Products RT-PCR and RACE Food Pathogen Detection & Screening Kits PCR Probes & Primer Sets Molecular Biology Cloning, Mapping & cDNA Synthesis Gene Transfer & Expression RNA/Protein/DNA Extraction Nucleic Acids Electrophoresis Instrumentation DNA Labeling & Detection Kits Sequencing, Mutagenesis & Mutation Analysis Molecular Biology Reagents Restriction Enzymes Modifying Enzymes: Kinases & RT Modifying Enzymes: Phosphatases Modifying Enzymes: Ligases Modifying Enzymes: DNA Polymerase Modifying Enzymes: RNA Polymerase Modifying Enzymes: Nucleases Modifying Enzymes: Rnase Inhibitor DNA Microarray Accessories Cell Biology Apoptosis Antibodies Bone Research Products Cell Adhesion & Extracellular Matrix Cell Differentiation Kit Cell Proliferation & Viability Signal Transduction Viral & Microbial Detection Protein Research Recombinant Protein Folding & Expression C-Terminal Isolation & Analysis N-Terminal Deblocking & Analysis Protein Fragmentation Protease Inhibition Glycobiology Glycobiology Kits Related Enzymes Order Products
About Takara Bio USA Clontech-Takara Bio USA Merger Contact Us Takara Subsidiares and Distributors How to Order Career Opportunities
Press Releases Trade Shows Company News
Home > Products > Molecular Biology > Nucleic Acids > SP6 Promoter Primer Details

SP6 Promoter Primer

Description:

Purity
  • Confirmed by HPLC
  • Primer activity is confirmed by the Sanger dideoxy method.
Intended Usage

Available as a primer for DNA sequencing of inserts cloned to plasmid vectors containing SP6 RNA polymerase promoters.

Primer Sequence

d(CATACGATTTAGGTGACACTATAG)

Product ships at room temperature.

Form:

Lyophilized

Storage:

–20°C

SP6 Promoter Primer TAK 3867 100 pmol 56.00
Product Name Product Number Size Price Qty Add

*All prices in USD